Genetic Engineering & Nanotechnology Mastery – Xchieve

CRISPR.editGene({target:"BRCA1",sequence:"ATGCGATCGATCG",repair:"homologous",efficiency:94.2}); gRNA.design(spacer="GCACTCGGATCGAGCTAGCT"); cas9.deliver(vector="AAV",tissue="somatic"); nanoparticle.synthesize({size:45,unit:"nm",material:"Au",coating:"PEG",functionalization:"antibody"}); DLS.measure(hydro_radius=52.3); zeta_potential=-18.7; drug_loading_efficiency=87.6%; PCR.amplify(template=genomicDNA,primer_F="ATGCGT...",primer_R="TTACGC...",cycles=35); gel.run(voltage=100,time=45); BLAST.align(query,database="NCBI_nr"); identity=99.3%; DNA.sequence(method="Illumina_NGS",coverage=30,readLength=150); variant.call(caller="GATK",filter="PASS"); annotation=VEP(assembly="GRCh38"); pathogenicity=ClinVar; nanoBot.program({size:"200nm",payload:"siRNA",target:"tumor_cell",trigger:"pH<6.5"}); delivery.efficiency=92.1%; cytotoxicity_assay(IC50=12.4,unit="nM"); cell_viability=97.8%; protein.express(vector="pET28a",host="E.coli_BL21",IPTG=0.5,temp=37); purify(method="Ni-NTA",imidazole=250); SDS_PAGE.run(); westernBlot.probe(antibody="anti-His"); flowCytometry.analyze(markers=["CD4","CD8","CD25"],events=10000); FACS.sort(purity=99.2%); confocal.image(objective=63x,laser=[488,561,647]); colocalization_coefficient=0.87;

Govt. Recognised 🧬 Industry-Integrated LIVE

🔬 Genetic Engineering & Nanotechnology Mastery Bootcamp

Genetic Engineering & Nanotechnology Mastery

From CRISPR & Gene Editing to Nanomaterial Synthesis & Drug Delivery Systems — Master Bioinformatics, Molecular Cloning & Nanofabrication and Land Roles at Top Biotech, Pharma & Research Institutions

⭐

4.9 / 5 Rating

By 3,800+ learners

⚡

Live Bootcamp

Included in course

🗓️

20 Weeks Online

Flexible schedule

✓

100% Placement

Career guaranteed

Lead Instructor Dr. Ritu Sharma, Ex-NIH Researcher

CRISPR-Cas9Nanomaterial SynthesisGene TherapyBioinformaticsDrug Delivery

Certified By

🏅 Skill India 🏛️ NSDC ⚖️ DBT Govt. ✅ ISO Certified

Our Alumni Hired At

Pfizer Novartis Biocon Dr. Reddy's CSIR-CCMB Serum Institute Sun Pharma Roche IIT Research Labs AstraZeneca

Course Fee

₹14,999 Today only

~~₹36,000~~ Save ₹21,001/-

★ 4.9/5 • 3,800+ learners

🕐 20 Weeks Online Programme
💼 100% Placement Assistance
🔬 Live Lab Simulations & Research Critiques

Enroll Now → Enquire Now View Course Brochure Connect with our team

🗓 Updated Jun '25 · T&C apply

🎓Placement Assistance ✦ 🔬Live Lab Simulation Sessions ✦ 🏆Govt. Certified ✦ ⚡Live Bootcamp ✦ 🧬CRISPR & Gene Editing Access ✦ ⚗️Nanomaterial Synthesis Modules ✦ 🎯1-on-1 Mentorship ✦ 💼Research Portfolio Building ✦ 📜Industry Certificate ✦ 🎓Placement Assistance ✦ 🔬Live Lab Simulation Sessions ✦ 🏆Govt. Certified ✦ ⚡Live Bootcamp ✦ 🧬CRISPR & Gene Editing Access ✦ ⚗️Nanomaterial Synthesis Modules ✦ 📜Industry Certificate ✦

Course Benefits

Why Choose This Course?

Get more than just education — join a comprehensive learning experience engineered for your success in the biotech, gene therapy, and nanotechnology industry

Industry-Recognized Certificate

Earn a verified certificate recognised by top biotech companies and research institutions including Pfizer, Novartis, Biocon, and CSIR labs — a credential hiring managers trust.

Live Lab Simulations & Critiques

Hands-on practice with CRISPR design tools, bioinformatics platforms, nanofabrication workflows, and molecular modelling software used by leading research labs worldwide.

Career Assistance

Get targeted career guidance, research-specific portfolio reviews, biotech interview preparation, and networking sessions with senior scientists, lab directors, and R&D heads at top pharma and nanotech firms.

Global Research Community

Join thousands of biotech and nanotech professionals worldwide and network with genetic engineers, nanotechnologists, and research scientists from top universities and global biotech companies.

Trusted by Industry Leaders

Our curriculum is designed in alignment with leading biotech companies and research institutions to ensure you learn the most in-demand genetic engineering and nanotechnology skills

Reviews from Students

Don't just take our word for it — hear what our students have to say about their Genetic Engineering & Nanotechnology learning experience

★★★★★4.9/5 from 3,100+ students

Arjun Srivastava

Research Scientist

Biocon

★★★★★

"The CRISPR-Cas9 and gene therapy modules are truly exceptional! The depth of coverage on gRNA design, off-target analysis, and delivery vectors is unmatched. The live lab simulation sessions prepared me perfectly for real research work. I landed my Research Scientist role at Biocon within 5 weeks of completing this programme."

Preethi Krishnan

Nanomaterials Engineer

Dr. Reddy's Labs

★★★★★

"The nanomaterial synthesis and drug delivery sections were incredibly detailed. The nanoparticle characterization workflows, DLS analysis, and zeta potential modules gave me a massive advantage in interviews. The capstone research project module alone is worth the entire course fee."

Varsha Reddy

Senior Bioinformatics Analyst

CSIR-CCMB

★★★★★

"Outstanding coverage of bioinformatics tools, NGS data analysis, and molecular cloning techniques. The real-world case studies on therapeutic gene editing and targeted drug delivery are exactly what top biotech companies look for. The mentor support throughout the bootcamp was excellent — the instructors have genuine industry experience!"

4.9/5

Average Rating

96%

Success Ratio

100%

Career Support

3.1k+

Success Stories

Course Content

Course Curriculum

A comprehensive learning path from molecular biology fundamentals to advanced CRISPR gene editing, nanomaterial synthesis, and industry-ready research workflows for biotech and pharma companies

52 Modules 210 Lessons 20 Weeks

▶DNA Structure, Replication, Transcription & Translation
▶Cell Signalling Pathways & Gene Regulation
▶Restriction Enzymes, Ligation & Cloning Strategies
▶Plasmid Vectors, Expression Systems & Transformation
▶PCR Techniques — Conventional, RT-PCR & Digital PCR
▶Protein Expression, Purification & Characterization
▶Overview of Modern Genetic Engineering Career Paths

▶CRISPR Mechanism — PAM Sequences, gRNA Design & Cas9 Activity
▶NHEJ vs HDR Repair Pathways — Knockout & Knockin Strategies
▶Base Editing, Prime Editing & Epigenome Editing Tools
▶Off-Target Analysis — Prediction Tools & Whole Genome Sequencing
▶CRISPR Delivery Vectors — AAV, Lentivirus & Nanoparticle Delivery
▶Cas Variants — Cas12, Cas13 & Anti-CRISPR Applications
▶Therapeutic Gene Editing — Clinical Trials & FDA Approvals
▶CRISPR Screens — Genome-Wide Functional Genomics
▶Benchling & Addgene — Designing & Sharing CRISPR Constructs
▶Project: Full CRISPR Experimental Design for a Disease Target

▶Nanoscale Science — Size-Dependent Properties & Quantum Effects
▶Top-Down vs Bottom-Up Nanofabrication Approaches
▶Gold, Silver & Iron Oxide Nanoparticle Synthesis
▶Liposomes, Polymeric & Lipid Nanoparticles for Drug Delivery
▶Carbon Nanotubes, Graphene & 2D Nanomaterials
▶Surface Functionalization — PEGylation, Antibody Conjugation & Targeting Ligands
▶Nanoparticle Characterization — DLS, TEM, SEM, AFM & Zeta Potential
▶Green Nanotechnology — Biogenic Synthesis & Sustainability
▶Self-Assembling Nanostructures — DNA Origami & Peptide Scaffolds
▶Project: Synthesize & Characterize a Targeted Nanoparticle System

▶Linux & Command-Line Tools for Bioinformatics Pipelines
▶BLAST, NCBI & Sequence Alignment — Local & Global Algorithms
▶Next-Generation Sequencing — Illumina, PacBio & Nanopore Platforms
▶NGS Data Analysis — FastQC, Trimmomatic, BWA & GATK
▶Variant Calling, Annotation & Pathogenicity Assessment
▶RNA-Seq Differential Expression Analysis — DESeq2 & edgeR
▶Phylogenetics, Evolutionary Analysis & Tree Construction
▶Protein Structure Prediction — AlphaFold2 & Rosetta
▶Project: End-to-End NGS Pipeline for Variant Discovery

▶Passive vs Active Targeting Strategies — EPR Effect & Receptor Targeting
▶Stimuli-Responsive Drug Release — pH, Redox, Light & Thermal Triggers
▶mRNA & siRNA Nanoparticle Delivery — LNP Formulation Principles
▶Cancer Nanomedicine — Theranostics & Photodynamic Therapy
▶Blood-Brain Barrier Crossing Strategies for CNS Drug Delivery
▶In Vitro Cytotoxicity & Cell Uptake Assays — MTT, Flow Cytometry & Confocal
▶Preclinical Animal Models & In Vivo Imaging of Nanoparticles
▶Regulatory Pathways — FDA & EMA Guidelines for Nano-Drugs
▶Scale-Up Challenges & GMP Manufacturing of Nanomedicines
▶Project: Design a Targeted Drug Delivery Nanoformulation

▶Viral vs Non-Viral Delivery — Advantages, Limitations & Applications
▶AAV Vector Design — Serotypes, Tropism & Production
▶Lentiviral & Retroviral Vectors — Stable Integration & Biosafety
▶Ex Vivo vs In Vivo Gene Therapy Approaches
▶CAR-T Cell Engineering & Adoptive Cell Therapies
▶Monogenic Disease Targets — Haemophilia, DMD, SMA & LCA
▶Regulatory & Ethical Considerations in Gene Therapy
▶Project: Gene Therapy Vector Design for a Target Disease

▶Synthetic Biology Design Principles — Genetic Circuits & Toggle Switches
▶Standardized Biological Parts — BioBricks & iGEM Registry
▶Metabolic Pathway Engineering for Bioproduction
▶Whole-Cell Biosensors & Diagnostic Applications
▶Directed Evolution & Protein Engineering Strategies
▶Computational Tools — SBOL, SnapGene & Benchling
▶Project: Design a Synthetic Genetic Circuit for Biosensing

▶What Makes a Great Science Portfolio — Research Summaries & Case Studies
▶Writing Compelling Research Abstracts & Posters
▶Portfolio Platforms — ResearchGate, Google Scholar & LinkedIn
▶Scientific Writing — Manuscripts, Grant Proposals & Protocols
▶Biotech CV Writing — Skills, Techniques & Publications
▶Project: Build a 3-Project Research Portfolio for Job Applications

▶Biosafety Levels BSL-1 to BSL-4 — Lab Practices & Containment
▶GMO Regulations — WHO, FDA & EU Directives
▶Ethics of Human Germline Editing & Enhancement
▶Dual-Use Research of Concern — Identifying & Mitigating Risks
▶Project: Regulatory Compliance Report for a Gene Therapy IND

▶AI Tools in Drug Discovery — DeepMind, Schrödinger & Insilico Medicine
▶Machine Learning for Genomic Variant Classification
▶Deep Learning for Protein Structure & Function Prediction
▶AI-Driven Nanoparticle Design & Optimization
▶The Future of Biotech — Organoids, Bioprinting & Molecular Machines
▶Project: AI-Assisted Drug Target Identification Capstone

How will your training work?

Follow our structured learning path designed to take you from biology basics to advanced gene editing and nanomaterial research through live lab critiques and expert scientist mentorship.

Step 01

Learn Concepts

Go through training videos covering molecular biology, CRISPR mechanisms, nanotechnology principles, and drug delivery systems at your own pace with expert scientist instructors.

Step 02

Test Yourself

Test your knowledge through module quizzes, experimental design challenges, and research interview-style practice assessments and take-home assignments.

Step 03

Live Lab Simulations

Work on real research briefs using CRISPR design tools, bioinformatics pipelines, nanofabrication workflows, and molecular modelling platforms. Build complete research proposals and experimental plans.

Step 04

1:1 Doubt Solving

Get your experimental and conceptual doubts resolved by senior scientists and ex-NIH/CSIR researchers through the Q&A portal within 24 hours.

Step 05

Take Final Exam

Complete your capstone research project — a fully documented experimental design with CRISPR strategy, nanoparticle synthesis plan, and bioinformatics analysis — and pass the final assessment.

Step 06

Get Certified

Earn your professional Genetic Engineering & Nanotechnology certification and placement support begins immediately — your research career awaits.

Professional Certifications

Industry-recognized & Government Approved Certificates

Verified certificates recognised by biotech companies, research institutions, and government bodies — the proof employers demand when hiring genetic engineers and nanotechnologists.

🏛️

Government

Skill India Certificate

Nationally recognised certificate issued under Skill India — Ministry of Skill Development & Entrepreneurship, validated for biotech and life sciences roles.

NSDC ApprovedGovt. Backed

🎓

Industry

NSDC Certification

National Skill Development Corporation certified course completion, trusted by top pharma companies, biotech startups, and research institutions across India.

Industry-RecognizedPan India

✅

Quality

ISO Certified Program

Our Genetic Engineering & Nanotechnology programme is ISO 9001:2015 certified, ensuring internationally recognised quality standards in science education.

ISO 9001:2015Global Standard

⚖️

Legal

DBT Govt. Approved

Department of Biotechnology approved certification that adds legal validity to your professional genetic engineer and nanotechnologist profile in India and internationally.

DBT VerifiedCorporate Valid

Xchieve vs Others

Why Choose Xchieve Over Others?

Compare our comprehensive Genetic Engineering & Nanotechnology learning experience with other popular platforms. See why thousands choose Xchieve to launch their biotech career.

Features

⭐ Best Value

Xchieve

Coursera

Udemy

edX

Government Certified Courses

NSDC, Skill India & DBT certified programs

✓

100% Career Assistance

Full placement & career support

✓

Live Lab Simulations & Critiques

Real CRISPR, bioinformatics & nano environments

✓

Live 1:1 Mentorship

Personal mentor from biotech & research industry

✓

Lifetime Course Access

Access all course materials forever

✓

24/7 Doubt Support

Round-the-clock science & research assistance

✓

Research Portfolio & Interview Prep

Science-specific portfolio reviews & mock interviews

✓

AI-Powered Learning Path

Personalised curriculum based on career goals

✓

Premium Research Community

Exclusive biotech & nanotech professional network

✓

Overall Score

9/9 ✦

4/9

3/9

Xchieve

⭐ Best Value

9 / 9 ✦

Government Certified Courses✓

100% Career Assistance✓

Live Lab Simulations & Critiques✓

Live 1:1 Mentorship✓

Lifetime Course Access✓

24/7 Doubt Support✓

Research Portfolio & Interview Prep✓

AI-Powered Learning Path✓

Premium Research Community✓

Coursera

4 / 9

Government Certified Courses✕

100% Career Assistance✕

Live Lab Simulations & Critiques✕

Live 1:1 Mentorship✕

Lifetime Course Access✓

24/7 Doubt Support✕

Research Portfolio & Interview Prep✓

AI-Powered Learning Path✕

Premium Research Community✓

Udemy

3 / 9

Government Certified Courses✕

100% Career Assistance✕

Live Lab Simulations & Critiques✕

Live 1:1 Mentorship✓

Lifetime Course Access✕

24/7 Doubt Support✓

Research Portfolio & Interview Prep✕

AI-Powered Learning Path✕

Premium Research Community✕

edX

3 / 9

Government Certified Courses✕

100% Career Assistance✕

Live Lab Simulations & Critiques✕

Live 1:1 Mentorship✕

Lifetime Course Access✓

24/7 Doubt Support✕

Research Portfolio & Interview Prep✓

AI-Powered Learning Path✕

Premium Research Community✕

Your Credentials

Certificates You'll Earn After Completing the Genetic Engineering & Nanotechnology Mastery Program

Earn verified credentials that showcase your biotech and nanotech expertise to employers and research institutions worldwide.

Course Completion Certificate

Acknowledge your hard work with a certificate from Xchieve upon successfully finishing the Genetic Engineering & Nanotechnology Mastery programme.

Research Internship Certificate

After completing a hands-on research and lab internship, you will receive an official certificate from Xchieve and top-tier biotech and pharma companies.

Industry Certificate

Earn a prestigious industry certificate from well-known biotech companies and research institutions as recognition of your practical genetic engineering and nanotechnology expertise.

Government Recognized Certificate

Receive NSDC & Skill India certified credentials backed by the Government of India's Ministry of Skill Development and Department of Biotechnology.

🏛️ Govt. Approved

✅ ISO Certified

🎓 NSDC Backed

⚖️ DBT Verified

1 / 4

Flexible Pricing

Pick the Plan That Launches Your Career

One-time payment. Lifetime access. Industry-recognised certificates included in every plan.

● StarterSave 50%

Self Paced Program

Study at your own speed

₹6,999

/course · ~~₹13,999~~

What's included

✓Genetic Engg. & Nanotech Video Lectures
✓Industry-Based Research Projects
✓Industry Graded Certificates
✓Doubt Clearing Sessions
✓Research Challenges & Quizzes
✓Personal Dashboard
—Placement Assistance
—AI Research Portfolio Review
—1-on-1 Career Counselling

Get Started →

⭐ Most PopularSave 50%

Mentor-led Program

Live guidance from research experts

₹10,999

/course · ~~₹21,999~~

🎉 Early bird price applied!

What's included

✓Genetic Engg. & Nanotech Video Lectures
✓Industry-Based Research Projects
✓Industry Graded Certificates
✓Doubt Clearing Sessions
✓Research Challenges & Quizzes
✓Personal Dashboard
✓Research Portfolio Building
✓AI Research Portfolio Review
—Placement Assistance
—1-on-1 Career Counselling

Start Learning →

● Premium🏆 Best Value

SAVE 50%

Career Edge

Everything you need to get hired

₹14,999

/course · ~~₹29,999~~

🎉 Extra early bird discount!

Everything included

✓Genetic Engg. & Nanotech Video Lectures
✓Industry-Based Research Projects
✓Industry Graded Certificates
✓Doubt Clearing Sessions
✓Research Challenges & Quizzes
✓Personal Dashboard
✓Research Portfolio Building
✓Personal Branding Workshop
✓Optimize Your ResearchGate & LinkedIn
✓AI Research Portfolio Review
✓Placement Assistance
✓1-on-1 Career Counselling
✓Research Internship Guarantee Letter
✓Priority Job Referrals to Biotech & Pharma

Start Learning →

🔒 Secure Payment ⚡ Instant Access ♾ Lifetime Updates 💬 24/7 Support

Got Questions?

Frequently Asked Questions

Everything you need to know before you enrol in our Genetic Engineering & Nanotechnology course. Can't find your answer? Reach out to us anytime.

Do I need prior biology or lab knowledge before joining?+

No prior laboratory or advanced biology experience is required. Our course starts from molecular biology fundamentals and builds progressively up to advanced CRISPR gene editing, nanomaterial synthesis, bioinformatics, and drug delivery systems. Students from engineering, pharmacy, chemistry, and non-science backgrounds have all successfully completed this programme.

Will I get access to CRISPR design tools, bioinformatics software, and lab simulation platforms?+

Yes! All enrolled students get guided access to Benchling for CRISPR and plasmid design, Galaxy for bioinformatics pipelines, NCBI and Ensembl databases, protein structure tools including AlphaFold2, and virtual lab simulation environments. Career Edge plan students also receive live lab critique sessions and real research briefs from partner biotech companies.

Is there a pre-registration option available?+

Yes, you can pre-register to lock in the early bird pricing before the next cohort begins. Pre-registered students are first to receive access and get exclusive onboarding resources including a CRISPR primer design guide, bioinformatics tool quick-start pack, and a nanomaterial characterization reference sheet.

What is the refund policy?+

Our courses are crafted with care and commitment, and as such, we do not offer refunds. We believe in the value and quality of our educational services and encourage you to attend a free demo session before enrolling.

What roles can I target after completing this course?+

Graduates from our programme have landed roles as Research Scientist, Genetic Engineer, Nanomaterials Engineer, Bioinformatics Analyst, Drug Delivery Scientist, Gene Therapy Specialist, and R&D Executive at companies including Pfizer, Novartis, Biocon, Dr. Reddy's Labs, CSIR-CCMB, Serum Institute, Roche, AstraZeneca, and leading IIT research labs.

What are the timings of the live sessions?+

Live mentor sessions and bootcamp classes are scheduled after 6 PM on weekdays and on weekends to suit working professionals and college students. Recordings are available within 24 hours for those who miss a session, including all live lab simulation walkthroughs and bioinformatics pipeline sessions.

Support Available 24/7

Still have questions?

Our expert biotech and research team is here to help — reach out anytime via chat, WhatsApp, or a free counselling call with a senior genetic engineer or ex-NIH/CSIR research scientist.

Free counselling call with research expert

15,000+ community members

No obligation to enroll

Average response time

Under 2 hours

Active community

15,000+ members

Contact Support Join WhatsApp Community

Genetic Engineering & Nanotechnology Mastery

Why Choose This Course?

Trusted by Industry Leaders

Reviews from Students

Course Curriculum

How will your training work?

Ready to Start Your Biotech Career?

Industry-recognized & Government Approved Certificates

Why Choose Xchieve Over Others?

Certificates You'll Earn After Completing the Genetic Engineering & Nanotechnology Mastery Program

Pick the Plan That Launches Your Career

Frequently Asked Questions